1181

Received 2018-04-14

Revised 2018-05-13

Accepted 2018-05-21

Genetic Variant of Glucocorticoid Receptor Gene at rs41423247 and Its Association with Major Depressive Disorder: A Case-Control Study

Negar Firouzabadi1, Hasti Nouraei2, Ali Mandegary 2,3

1 Department of Pharmacology & Toxicology, School of Pharmacy, Shiraz University of Medical Sciences, Shiraz, Iran

2 Department of Toxicology & Pharmacology, School of Pharmacy, Kerman University of Medical Sciences, Kerman, Iran

3 Pharmaceutics Research Center, Neuropharmacology Institute, Kerman University of Medical Sciences, Kerman, Iran

Abstract

Background: Extensive distribution of glucocorticoid receptors (GCRs) in different brain areas along with disruption of hypothalamic-pituitary-adrenal (HPA) axis in major depressive disorder (MDD) and the cross talk between GCRs and HPA proposes genetic variants of GC receptor genes as potential contributors in MDD. Among the GCR polymorphisms, rs41423247, rs6195 and rs6189/rs6190 are suggested to be involved in MDD. Materials and Methods: We investigated the association between rs41423247, rs6195 and rs6189/rs6190 and MDD in a case-control study. One hundred MDD patients along with 100 healthy individuals were enrolled in this study. genetic variants of rs41423247, rs6195 and rs6189/rs6190 were determined in extracted DNAs using PCR-RFLP. Result: The prevalence of heterozygote and mutant carriers of rs41423247 were significantly and by 1.9 fold greater in cases versus controls (P=0.033; OR; 95%CI=1.9; 1.1-3.3). Moreover, carriers of the mutant (G) allele were by 1.8 fold more prevalent in MDD group (P=0.013; OR;95%CI=1.8; 1.1-2.8). Conclusion: Specific carriers of rs41423247 might be more susceptible to developing MDD. This supports the hypothesis of the involvement of GCRs in pathophysiology of MDD.[GMJ.2018;7:e1181] DOI:10.22086/gmj.v0i0.1181

Keywords: Glucocorticoid receptor; Genetic variant; Single nucleotide polymorphism; Major depressive disorder

Introduction

Major depressive disorder (MDD) as an enigmatic psychological disorder with a high prevalence [1], is currently considered as one of the main five causes of disability globally and will be the second foremost cause of disability by the year 2020 [2, 3]. Multiple biological and environmental parameters along with genetic and epigenetic factors have been proposed to be linked to MDD [4-6].

However, the exact mechanism involved in pathophysiology of MDD is not clear to date [1]. Glucocorticoids (GCs) having an essential role in controlling neuroendocrine and inflammatory and responses to various challenges like stress [7, 8], suppress critical inflammatory pathways such as outflows of the hypothalamic-pituitary-adrenal (HPA) axis [9]. Malfunction of the GC system in suppressing inflammation results in many illnesses including MDD [10] in which one of the main findings is the alteration in GC resistance [11, 12]. Dysregulation of the HPA axis is proposed to be the foremost cause of depression [13-15]. Forebrain GC receptors (GCRs) have been implicated to contribute to HPA axis regulation and depression. These receptors are extensively found in cognitive regions of the forebrain [16, 17]. Decreased GCR mRNA expression is detected in cortex and hippocampus of MDD patients [18] which is surprisingly increased after antidepressant treatment [19, 20] and partial GCR resistance is restored [21]. Considering that the exact mechanism of GC resistance in MDD is unknown to date, the influence of genetics in both MDD and GC resistance is undeniable. Therefore genetic factors leading to alteration in GCR sensitivity might affect susceptibility to MDD. It is claimed that some GCR genetic variants can alter the structure of hippocampus and the integrity of its subdivisions which may contribute to MDD [22, 23].rs41423247 (BclI) polymorphism is located in intron 2 of GCR gene resulting in displacement of G to C nucleotide [24]. rs6195 (N363S) polymorphism located in exon 2 of GCR gene results in a change of asparagine to serine [25]. These two variants are reported to be associated with GC sensitivity. Another variant located in exon 2 of GCR gene, is rs6189/rs6190 (ER22/23EK) with two linked nucleotide variations in codons 22 and 23 resulting in GCR resistance [26]. In this study we investigated the potential association of three genetic variants of GCRs (rs41423247, rs6189/rs6190 and rs6195) with MDD, for the first time, in a group of depressed Iranian patients.

Materials and Methods

One hundred MDD patients (male: 33, Female: 67, mean age± SD= 32.58±10.65) were included in our case-control study. They were recruited from Hafez Hospital, Shiraz, Iran. All participants were interviewed by the samepsychiatrist and MDD was diagnosed and confirmed according to Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-V) criteria [27] and the severity of depression was evaluated with an initial 21 item Hamilton Depression Rating Scale (HDRS) [28].Only patients with no history of antidepressant medication use and negative previous diagnosis of depression were included in our study.patients with the following conditions were excluded from the study: a family history of schizophrenia, a personal history of bipolar disorder, a family history of bipolar disorder in first degree relatives; a personal history of schizophrenia, manic or hypomanic episode, mood incongruent psychotic symptoms, active substance dependence, and current treatment with antipsychotics or mood stabilizers and significant medical condition,inflammatory illnesses such as irritable bowel disease (IBD), rheumatoid arthritis (RA) and gout,cancer, cardiovascular diseases and diabetes.

the control group comprised of 100 healthy and unrelated individuals (male: 44, Female: 56, mean agent± SD: 32.83±13.53) attending routine health checkups who volunteered to be interviewed by the psychiatrist. Healthy volunteers were with no evidence of underlying diseases (psychiatric disorders, auto immune diseases, cancer, IBD, diabetes, hypertension, hyperlipidemia and obesity). all participants were interviewed by the same psychiatrist using a similar protocol (DSM-IV criteria) in order to rule out psychiatric illnesses.

All 200 participants were Iranian, from the same geographical area and born from Iranian parents.

DNA extraction and genotyping

DNAs of both control and case group were extracted using whole blood and by a standard protocol [29]. PCR amplification of rs41423247, rs6195 and rs6189/rs6190 was performedusing primers and enzymes listed in Table-2.The PCR amplification of variants was performed as previously described [30]. After 3-16 hours of incubation, for separating digested fragments electrophoresis on agarose (Invitrogen Ultra Pure®) gel 2% was performed After staining with ethidium bromide the gel was visualized in a UV trans illuminator. All the samples were double checked and reconfirmed(Table-1).

Statistics

SPSS 21.0 for Windows (SPSS Inc., Chicago) was used for data analysis. . C

hi-square test was used to asses Hardy–Weinberg equilibrium (HWE) for distribution of genotypes . Continuous variables are shown as mean ± SD. Genotype frequencies are shown in percentage (%). Normal Distribution of continuous variables was tested with the Kolmogorov–Smirnov test. to assess genotype and allelic distribution differences between the two groups Pearson’s chi-square or Fisher’s exact test were applied Odds ratio (OR) and 95% confidence intervals (CI) were reported . P value <0.05 was considered as statistically significant.

Result

Demographic characteristics of healthy controls and patients with MDD are listed in Table-2. Characteristics of healthy and MDD groups were compared regarding variables. No significant differences were observed between the two groups with regard to age, sex and BMI (P=0.351, 0.146, 0.356 respectively).Table-3 demonstrates genotype and allele frequencies of MDD individuals and healthy participants. There was a significant association between CG and GG genotype of rs41423247 and MDD (P=0.033; OR; 95%CI=1.9; 1.1-3.3). In addition, G allele of rs41423247 was also associated with depression (P=0.013; OR; 95%CI=1.8; 1.1-2.8). There was no significant association between genotypes and alleles of rs6195 and rs6189/rs6190 variants and MDD (P value˃0.05).

Discussion

As far as surveyed, this is the first study examining the possible association of MDD with variants of GCR in a depressed Iranian population. Here we found a significant association between CG and GG genotype of rs41423247 and MDD. Moreover, carriers of the G allele of rs41423247 were also by 1.8 fold more prevalent in MDD group versus controls than carriers of the C allele.MDD, the most common psychiatric disorder has the lifetime prevalence of 8-12% [31]. In addition to the neurotransmitters the endcrine system plays an influential part in the pathophysiology of this disorder [32]. Among the many endocrine features present in MDD is the hyperactivity of HPA axis resulting in high serum levels of cortisol, the most important GC in human [33], which binds selectively to GCRs. The GCRs are believed to be the major receptors in the regulation of response to stress in situations like MDD where GC levels are high [12]. After binding to GCRs, this complex translocates into the nucleus. Thereafter it can either bind to GC responsive elements on DNA or directly to transcription factors which results in upregulation or downregulation of transcription of target genes [34]. Studies on psychiatric disorders revealed that GCRs are either deleted or overexpressed in the entire brain, too early in life, therefore it is difficult to attribute particular regions of the brain to each observed phenotype. However, the GCR in the forebrain has been shown to regulate the HPA axis and behaviour under stressed conditions such as MDD [35]. The high expression of GCR in formation of the hippocampus explains the atrophic response to stress and stress hormones in these parts of the human brain [36]. One of the major possibilities regarding the mechanism of GCRs in depression is the primary change in GCR genetic structure [37]. Among the genetic variants of GCRs rs41423247, rs6189/rs6190 and rs6195 were found to be associated with alteration in changes in cortisol levels or GC sensitivity [24, 38]. As previously reported, sensitivity and resistance to GCs can both lead to MDD. Heterozygote and mutant variants of rs41423247 are associated with increased sensitivity to GCs and a positive feedback on CRH in the limbic system [24]. However, this variant has a dual tissue-specific characteristic with both increase and decrease sensitivity to GCs. Elevated CRH in the limbic regions has been associated with depressive behaviour [11]. On the other hand increased GCR resistance has been shown to be a hallmark of endocrine dysregulation in MDD [11, 12]. In line with the previous study by van Rossum et al. our results indicate a positive association between mutant and heterozygote genotypes as well as mutant allele of rs41423247 with development of MDD [38]. A report in polish population also indicated an association between this variant and MDD [39]. Likewise a study in postmenopausal women with depression showed a positive association of rs41423247 with MDD [40]. Confirming our observed results, a report is suggestive of reduction in HDRS core in carriers of mutant variants of rs41423247 [41]. Studies regarding association of rs41423247 variants and response to antidepressants were also in line with our finding [30,38 , 42, 43]. In contrast to our finding a study suggests an association between heterozygote variants of rs41423247 and less vulnerability for recurrent depressive symptoms [44]. Considering the intronic position of rs41423247 and the unknown molecular consequence of this polymorphism on GCR physiology, it is assumed that this variant may be linked to other functional variants in the 3’ untranslated region or the promoter region of the GR gene [41]. Regarding rs6189/rs6190 and rs6195 polymorphisms, our results showed lack of association with MDD. A report in Dutch population however showed a positive association of the mutant form of rs6189/rs6190 polymorphism with MDD and antidepressant treatment but lack of association with regard to rs6195 [38]. Confirming our results, a previous report in an Iranian depressed population is suggestive of lack of association between these variants and response to fluoxetine [30]. These conflicting results might be due to ethnical differences on one hand and the low frequencies of these two rare genetic variants in various populations. In future studies these finding are urged to be replicated in larger populations and with different ethnicities.It is worth mentioning that in this study only the newly diagnosed MDD patients were enrolled, which refers to the absence of other concomitant psychiatric illnesses. Moreover patients with illnesses such as IBD, RA, neoplasms, cardiovascular diseases, gout and diabetes were excluded. Therefore, the impact of other confounding factors are minimized.

Acknowledgment

The authors would like to sincerely acknowledge Dr. Ali Alavi Shoushtari for his kind contribution towards patient selection.

Conflict of interest

The authors declare no conflict of interest.

Correspondence to:

Negar Firouzabadi PhD, Department of Pharmacology & Toxicology, School of Pharmacy, Shiraz University of Medical Sciences, Shiraz, Iran,

Telephone Number: +989173145303

Email Address : nfirouzabadi@yahoo.com

GMJ.2018;7:e1181

www.gmj.ir

Table 2. Demographic Characteristics of Depressed Patients and Healthy Individuals.

Variables

Depressed Patients

Healthy control

P value

Sex (male/female)

33/67

44/56

0.146

Age (years) Mean ± SD

32.58±١٠.٦٨

32.83±13.53

0.351

BMI (kg/m2) Mean ± SD

24.76 ±0.38

24.53 ±0.43

0.356

SD: Standard deviation; BMI: Body mass index

Table 1. Primer Sequences, Restriction Enzymes and Locations of rs41423247, rs6195, and rs6189/rs6190 Polymorphisms on DNA.

Polymorphisms

Primer sequence (5′-3′)

DNA bp

Restriction enzyme digestion

DNA Fragment size(base pair)

References

rs41423247 (BclI)

F-5_TGCTGCCTTATTTGTAAATTCGT -3

R-5_AAGCTTAACAATTTTGGCCATC -3

335

BclI

335/222/117

Bachmann, et al. [45] 2005

rs6195 (N363S)

F-5_AGTACCTCTGGAGGACAGAT_3

R-5_GTCCATTCTTAAGAAACAGG_3

243

Tsp509I

153/134/95/19

Huizenga, et al. [25] 1998

rs6189/rs6190 (ER22/23EK)

F-5_TGCATTCGGAGTTAACTAAAAAG_3

R-5_ATCCCAGGTCATTTCCCATC _3

448

MnlI

184/163/149/ 50/49/35

Panek ,et al. [46] 2014

Table 3. Frequencies of Three Polymorphisms of the Glucocorticoid Receptor Gene in Healthy and MDD Patients.

Variant

Healthy participants (N=100)

MDD Patients (N=100)

PC

OR

95%CI

rs41423247

0.033

1.9

1.1-3.3

CC

59 (59%)

43 (43%)

CG

39 (39%)

48 (48%)

GG

2 (2%)

9 (9%)

Alleles

0.013

1.8

1.1-2.8

C

157 (78.5%)

134 (67%)

G

43 (21.5%)

66 (33%)

rs6195

1

1.5

0.2-9.2

TT

98 (98 %)

97 (97%)

AA

2 (2%)

3 (3%)

Alleles

0.75

1.5

0.4-5.4

A

196 (98.0 %)

194 (94.0%)

T

4 (2.0%)

6 (6.0%)

rs6189/rs6190

1

0.8

0.2-2.8

AA

94 (94%)

95 (95%)

TT

6 (6%)

5 (5%)

Alleles

0.83

0.8

0.3-1.9

A

188 (94.0%

190 (95.0%)

T

12 (94%)

10 (5.0%)

MDD: Major depressive disorder; OR:Odds ratio; Cl:Confidence Interval; PC:P Value for Chi-square Test

References

  1. Belmaker R, Agam G. Major depressive disorder. N Engl j Med. 2008;2008(358):55-68.
  2. Marcus M, Yasamy MT, van Ommeren M, Chisholm D, Saxena S. Depression: A global public health concern. WHO Department of Mental Health and Substance Abuse. 2012;1:6-8.
  3. Blazer DG, Kaplan BH. Controversies in community-based psychiatric epidemiology: let the data speak for themselves. Archives of general psychiatry. 2000;57(3):227-8.
  4. Kim Y-K, Na K-S, Shin K-H, Jung H-Y, Choi S-H, Kim J-B. Cytokine imbalance in the pathophysiology of major depressive disorder. Progress in Neuro-Psychopharmacology and Biological Psychiatry. 2007;31(5):1044-53.
  5. Lopez-Leon S, Janssens A, Ladd AG-Z, Del-Favero J, Claes S, Oostra B et al. Meta-analyses of genetic studies on major depressive disorder. Molecular psychiatry. 2008;13(8):772.
  6. Kendler KS, Kessler RC, Walters EE, MacLean C, Neale MC, Heath AC et al. Stressful life events, genetic liability, and onset of an episode of major depression in women. Focus. 2010;8(3):459-70.
  7. Raison CL, Miller AH. When not enough is too much: the role of insufficient glucocorticoid signaling in the pathophysiology of stress-related disorders. American Journal of Psychiatry. 2003;160(9):1554-65.
  8. Solomon MB, Furay AR, Jones K, Packard AE, Packard BA, Wulsin AC et al. Deletion of forebrain glucocorticoid receptors impairs neuroendocrine stress responses and induces depression-like behavior in males but not females. Neuroscience. 2012;203:135-43.
  9. Pace TW, Hu F, Miller AH. Cytokine-effects on glucocorticoid receptor function: relevance to glucocorticoid resistance and the pathophysiology and treatment of major depression. Brain, behavior, and immunity. 2007;21(1):9-19.
  10. Pariante CM. Glucocorticoid receptor function in vitro in patients with major depression. Stress. 2004;7(4):209-19.
  11. Holsboer F. The corticosteroid receptor hypothesis of depression. Neuropsychopharmacology. 2000;23(5):477.
  12. Pariante CM, Miller AH. Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biological psychiatry. 2001;49(5):391-404.
  13. Vreeburg SA, Hoogendijk WJ, van Pelt J, DeRijk RH, Verhagen JC, van Dyck R et al. Major depressive disorder and hypothalamic-pituitary-adrenal axis activity: results from a large cohort study. Archives of general psychiatry. 2009;66(6):617-26.
  14. Stetler C, Miller GE. Depression and hypothalamic-pituitary-adrenal activation: a quantitative summary of four decades of research. Psychosomatic medicine. 2011;73(2):114-26.
  15. Herman JP, Figueiredo H, Mueller NK, Ulrich-Lai Y, Ostrander MM, Choi DC et al. Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo–pituitary–adrenocortical responsiveness. Frontiers in neuroendocrinology. 2003;24(3):151-80.
  16. Herman JP, Ostrander MM, Mueller NK, Figueiredo H. Limbic system mechanisms of stress regulation: Hypothalamo-pituitary- adrenocortical axis. Progress in Neuro-Psychopharmacology and Biological Psychiatry. 2005;29(8):1201-13. doi:10.1016/j.pnpbp.2005.08.006.
  17. Calfa G, Kademian S, Ceschin D, Vega G, Rabinovich G, Volosin M. Characterization and functional significance of glucocorticoid receptors in patients with major depression: modulation by antidepressant treatment. Psychoneuroendocrinology. 2003;28(5):687-701.
  18. Modell S, Yassouridis A, Huber J, Holsboer F. Corticosteroid receptor function is decreased in depressed patients. Neuroendocrinology. 1997;65(3):216-22.
  19. Pariante CM, Makoff A, Lovestone S, Feroli S, Heyden A, Miller AH et al. Antidepressants enhance glucocorticoid receptor function in vitro by modulating the membrane steroid transporters. British journal of pharmacology. 2001;134(6):1335-43.
  20. Anacker C, Zunszain PA, Cattaneo A, Carvalho LA, Garabedian MJ, Thuret S et al. Antidepressants increase human hippocampal neurogenesis by activating the glucocorticoid receptor. Molecular psychiatry. 2011;16(7):738.
  21. Montkowski A, Barden N, Wotjak C, Stec I, Ganster J, Meaney M et al. Long-term antidepressant treatment reduces behavioural deficits in transgenic mice with impaired glucocorticoid receptor function. Journal of neuroendocrinology. 1995;7(11):841-5.
  22. Won E, Kang J, Kim A, Choi S, Han K-M, Tae WS et al. Influence of BclI C/G (rs41423247) on hippocampal shape and white matter integrity of the parahippocampal cingulum in major depressive disorder. Psychoneuroendocrinology. 2016;72:147-55.
  23. Castellini G, Lelli L, Tedde A, Piaceri I, Bagnoli S, Lucenteforte E et al. Analyses of the role of the glucocorticoid receptor gene polymorphism (rs41423247) as a potential moderator in the association between childhood overweight, psychopathology, and clinical outcomes in Eating Disorders patients: A 6 years follow up study. Psychiatry research. 2016;243:156-60.
  24. Van Rossum EF, Koper JW, Van Den Beld AW, Uitterlinden AG, Arp P, Ester W et al. Identification of the BclI polymorphism in the glucocorticoid receptor gene: association with sensitivity to glucocorticoids in vivo and body mass index. Clinical endocrinology. 2003;59(5):585-92.
  25. Huizenga NA, Koper JW, de Lange P, Pols HA, Stolk RP, Burger H et al. A polymorphism in the glucocorticoid receptor gene may be associated with an increased sensitivity to glucocorticoids in vivo. The Journal of Clinical Endocrinology & Metabolism. 1998;83(1):144-51.
  26. van Rossum EF, Koper JW, Huizenga NA, Uitterlinden AG, Janssen JA, Brinkmann AO et al. A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes. 2002;51(10):3128-34.
  27. Association D-AP. Diagnostic and statistical manual of mental disorders. Arlington: American Psychiatric Publishing. 2013.
  28. Hamilton M. A rating scale for depression. Journal of neurology, neurosurgery, and psychiatry. 1960;23(1):56.
  29. Miller S, Dykes D, Polesky H. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research. 1988;16(3):1215.
  30. Nouraei H, Firouzabadi N, Mandegary A, Zomorrodian K, Bahramali E, Shayesteh MRH et al. Glucocorticoid Receptor Genetic Variants and Response to Fluoxetine in Major Depressive Disorder. The Journal of neuropsychiatry and clinical neurosciences. 2017;30:45-50..
  31. Demyttenaere K, Bruffaerts R, Posada-Villa J, Gasquet I, Kovess V, Lepine J et al. Prevalence, severity, and unmet need for treatment of mental disorders in the World Health Organization World Mental Health Surveys. Jama. 2004;291(21):2581-90.
  32. Brambilla F. Psychoneuroendocrinology: research on the pituitary adrenal-cortical system. Psychosomat Med. 2000;62:576-607.
  33. Wüst S, Van Rossum EF, Federenko IS, Koper JW, Kumsta R, Hellhammer DH. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. The Journal of Clinical Endocrinology & Metabolism. 2004;89(2):565-73.
  34. Buttgereit F, Burmester G-R, Lipworth BJ. Optimised glucocorticoid therapy: the sharpening of an old spear. The Lancet. 2005;365(9461):801-3.
  35. Arnett MG, Kolber BJ, Boyle MP, Muglia LJ. Behavioral insights from mouse models of forebrain-and amygdala-specific glucocorticoid receptor genetic disruption. Molecular and cellular endocrinology. 2011;336(1):2-5.
  36. McEwen BS. Glucocorticoids, depression, and mood disorders: structural remodeling in the brain. Metabolism. 2005;54(5):20-3.
  37. Bamberger CM, Schulte HM, Chrousos GP. Molecular determinants of glucocorticoid receptor function and tissue sensitivity to glucocorticoids. Endocrine reviews. 1996;17(3):245-61.
  38. van Rossum EF, Binder EB, Majer M, Koper JW, Ising M, Modell S et al. Polymorphisms of the glucocorticoid receptor gene and major depression. Biological psychiatry. 2006;59(8):681-8.
  39. Gałecka E, Szemraj J, Bieńkiewicz M, Majsterek I, Przybyłowska-Sygut K, Gałecki P et al. Single nucleotide polymorphisms of NR3C1 gene and recurrent depressive disorder in population of Poland. Molecular biology reports. 2013;40(2):1693-9.
  40. Krishnamurthy P, Romagni P, Torvik S, Gold P, Charney D, Detera-Wadleigh S et al. Glucocorticoid receptor gene polymorphisms in premenopausal women with major depression. Hormone and metabolic research. 2008;40(03):194-8.
  41. Brouwer JP, Appelhof BC, van Rossum EF, Koper JW, Fliers E, Huyser J et al. Prediction of treatment response by HPA-axis and glucocorticoid receptor polymorphisms in major depression. Psychoneuroendocrinology. 2006;31(10):1154-63.
  42. Takahashi H, Yoshida K, Higuchi H, Kamata M, Inoue K, Suzuki T et al. Bcl1 Polymorphism of the Glucocorticoid Receptor Gene and Treatment Response to Milnacipran and Fluvoxamine in Japanese Patients with Depression. Neuropsychobiology. 2014;70(3):173-80.
  43. Ventura-Juncá R, Symon A, López P, Fiedler JL, Rojas G, Heskia C et al. Relationship of cortisol levels and genetic polymorphisms to antidepressant response to placebo and fluoxetine in patients with major depressive disorder: a prospective study. BMC psychiatry. 2014;14(1):220.
  44. Bet PM, Penninx BWJH, Bochdanovits Z, Uitterlinden AG, Beekman ATF, van Schoor NM et al. Glucocorticoid receptor gene polymorphisms and childhood adversity are associated with depression: New evidence for a gene–environment interaction. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics. 2009;150B(5):660-9. doi:10.1002/ajmg.b.30886.
  45. Bachmann AW, Sedgley TL, Jackson RV, Gibson JN, Young RM, Torpy DJ. Glucocorticoid receptor polymorphisms and post-traumatic stress disorder. Psychoneuroendocrinology. 2005;30(3):297-306.
  46. Panek M, Pietras T, Szemraj J, Kuna P. Association analysis of the glucocorticoid receptor gene (NR3C1) haplotypes (ER22/23EK, N363S, BclI) with mood and anxiety disorders in patients with asthma. Experimental and therapeutic medicine. 2014;8(2):662-70.

Refbacks

  • There are currently no refbacks.